Aganirsen
Highest phase reached
Phase 2
Drug type
Oligonucleotide
- Listing at source
- Listed
- Highest phase reached
- Phase 2
- Drug type
- Oligonucleotide
- Drug name
- Aganirsen
- (3'->5')D(P-THIO)(T-A-T-C-C-G-G-A-G-G-G-C-T-C-G-C-C-A-T-G-C-T G-C-T)
- 3 5 d p thio t a t c c g g a g g g c t c g c c a t g c t g c t
- aganirsen
- Aganirsen
- aganirsen [INN]
- Aganirsen [WHO-DD]
- aganirsen inn
- aganirsen who dd
- gs 101
- Gs-101
- CAS registry numbers
- 1146887-67-3
- ChEMBL ID
- CHEMBL2108296
- FDA ingredient codes (UNII)
- 0N3FY8225K
- Patents
- 0
- Designations
- 1
- First in class
- No
- Fast track
- No
- Breakthrough designation
- No
- Orphan designation
- No
- Priority review
- No
- Orphan exclusivity
- No
- Accelerated approval
- No
- Drug name stem
- -rsen
- Mechanism
- Insulin receptor substrate 1 mRNA antisense inhibitor
- Action type
- ANTISENSE_INHIBITOR
- Target
- Insulin receptor substrate 1 mRNA
- Protein identifier
- ENSG00000169047
- Mechanism
- Insulin receptor substrate 1 mRNA antisense inhibitor
- Action type
- Inhibitor
- Target
- Insulin receptor substrate 1 mRNA
- Protein identifier
- ENSG00000169047
Open Targets mechanisms
- Mechanism
- Insulin receptor substrate 1 mRNA antisense inhibitor
- Action type
- ANTISENSE INHIBITOR
- Target
- Insulin receptor substrate 1 mRNA
Open Targets indications
- Condition identifier
- MONDO_0004980
- Highest recorded phase
- 3
- Prodrug
- No
- Chirality
- Single enantiomer
- Inorganic
- No
- Natural product
- No
Sequences
- Component
- Sequence
- Type
- Nucleic Acid
- Sequence
- (3'-5')D(P-THIO)>TATCCGGAGGGCTCGCCATGCTGCT
Related records
Trials (3)
- A Phase 1 Clinical Study Comparing GS101 and Dupixent® After Subcutaneous Injection
- A Phase III Study of GS101 Injection to Dupixent®
- Trial of Aganirsen in iCRVO Patients at Risk of Developing NVG
In development for (1)
- Atopic eczema Phase 3
Targets (1)
- IRS1 Insulin receptor substrate 1 mRNA antisense inhibitor